244. Repeated DNA Sequences (Count)

Given a DNA string s composed of 'A','C','G','T', return the number of distinct 10-letter-long substrings that occur more than once in s.

Input: A quoted DNA string.

Output: Integer — count of repeated 10-mers.

Examples

Example 1

Input: "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: 2
Explanation: Two 10-mers repeat.

Example 2

Input: "AAAAAAAAAAAAA"
Output: 1
Explanation: 'AAAAAAAAAA' repeats.

Example 3

Input: "ACGT"
Output: 0
Explanation: Too short.